tatianaamazo tatianaamazo
  • 04-04-2018
  • Social Studies
contestada

Nickname of British soldiers

Respuesta :

nataliegarciaym
nataliegarciaym nataliegarciaym
  • 04-04-2018
redcoats is the correct answer
Answer Link

Otras preguntas

What would be the most likely effect of one company buying a competitor?
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
find the prime factorization 504
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.