DartGoblin4657 DartGoblin4657
  • 02-03-2018
  • Social Studies
contestada

Who was the person who signed on the declration of indpendce with huge signature

Respuesta :

Аноним Аноним
  • 02-03-2018
John hancock was the person

Answer Link
turdguy420 turdguy420
  • 02-03-2018
John Hancock was the person with the large signature.
Answer Link

Otras preguntas

A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
How many times does four go into 153 ? What Is the remainder ?
What Role Does the Sun Play in Producing Winds And Ocean Currents
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.