teslajohnson10 teslajohnson10

01-02-2018
English

contestada

The Iliad and The Odyssey are extended _____ that led to the emergence of the novel. narrative poems dramatic plays dramas plays

Respuesta :

calebts34 calebts34

01-02-2018

The Illiad and the Odyssey are considered narratives or narrative poems.

Answer Link

Otras preguntas

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

If you believe the economy is about to go into a recession and your portfolio consists of growth stocks, defensive stocks and long-term bonds, you might change

find the missing value in the equivalent ratio 18:27=

−6x−3(x−2) PLEASE HELP

What is the slope of the line that passes through the points (0,-7) and (-4,3)

The league championship 800 meter race has 9 runners. In how many different ways they place first, second and third?

Which sentence is punctuated correctly

These are segments of the columnar stem of what fossil echinoderm animal? Each disk is a single crystal of calcium carbonate, and in life the animal's living ti

Which sentence most likely comes from a narrative essay? The best way to ensure that the eggs don't scorch is to keep an eye on them and stir continuously. Nerv

2. Which one of the following statements are true of the sample of matter described by Figure1?a. As heat is added to the sample, its temperature always increas