Destani1
Destani1 Destani1
  • 03-09-2015
  • Mathematics
contestada

is 16.7 a reasonable sum for 7.5 + 9.2 explain

Respuesta :

Аноним Аноним
  • 03-09-2015
7.5 + 9.2

= 7.0 + 0.5 + 9.0 + 0.2

= 7.0 + 9.0 + 0.5 + 0.2

= 16.0 + 0.7

= 16.7

Yes, it's a reasonable sum - and the calculation above you demonstrates why.
Answer Link

Otras preguntas

Question 16 (5 points)   How are the two angles related? Question 16 options: adjacent complementary supplementary vertical
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The degree measure of angle a is 135°. which expression below is equivalent to the radian measure of angle a?
why is the inner mitochondrial membrane folded
the volume of a sphere is 2254 pi ^3 what is the surface area of the sphere
Jacqui has grades of 87 and 84. if she wants an average of 78 what does she have to score
What major events led to the establishment of the navy and the department of the navy?
please help if you know, thanks!
Suppose n is odd. find the cube of n and divide it by 4. what possible remainders could occur? check all the possible ones and none of the impossible ones.
Really need some helpUse the diagram below. Write AD/AB in simplest form.