halgal17 halgal17
  • 03-05-2017
  • History
contestada

The most important part of the economy in Northwest China is _____.

Respuesta :

wdp180280wynter3456
wdp180280wynter3456 wdp180280wynter3456
  • 11-08-2018

the most important part is tourism

Answer Link
kbendps63or3ewj
kbendps63or3ewj kbendps63or3ewj
  • 13-12-2018

Raising livestock is the right one :)


Answer Link

Otras preguntas

What property is shown by the equation? 1. 0 ÷ (–6) = 0
What was religion like in Shang China?
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
the temperature of a sample of matter is a measure of the ?
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
what was NOT a primary goal of marriage in a feudal system at the noble level? A. Exchange of land and goods B. love and companionship C. Political arrangement
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front