deadfishy2373 deadfishy2373
  • 01-02-2022
  • Mathematics
contestada

A micron is 1x10 to the 6th power. write that number and unit in standard form.

Respuesta :

DkLiverpool DkLiverpool
  • 01-02-2022
6000000 just add 6 zeros at the end
Answer Link
sam8775 sam8775
  • 01-02-2022
6000000
Just add whatever power that’s needed
Answer Link

Otras preguntas

the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
what is the most common type of vegetation throughout Latin America
the temperature of a sample of matter is a measure of the ?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The section of the small intestine between the duodenum and ilium?
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
the temperature of a sample of matter is a measure of the ?
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate