ana14huber
ana14huber ana14huber
  • 03-10-2021
  • Mathematics
contestada

The quotient of a number and 7 is 9

Respuesta :

940172
940172 940172
  • 03-10-2021

Answer:

63    

Step-by-step explanation:

63/7=9

Answer Link

Otras preguntas

what does a light year measure
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
HELP ASAPIdentify the property used in each step. 12.2 + 18.6 + –4.3 + (–18.6) 12.2 + –4.3 + 18.6 + (–18.6) 12.2 + –4.3 + [18.6 + (–18.6)] 12.2 +
What is foster’s overall point about journeys or trips in literature?
The national competency-based credential for entry-level early childhood educators is called?
Helppppp how do u do this????
Raquel recently received a poor grade on a school assignment. Her mother has noticed that Raquel is staying up late at night and hides in her room. Raquel is re
What is the distance between points (-42, 63) and (-39, 67)?
4/y+2 - 9/y-2 = 9/y^2-4
Caleb solved this equation and recorded his work. 7.4x + 4.1(2x − 4) = −2.3(x − 6) − 21.6 1. 7.4x + 8.2x − 16.4 = −2.3x + 13.8 − 21.6 2. 15.6x − 16.4 = −2.3x