Seudónimo Seudónimo
  • 04-04-2021
  • Mathematics
contestada

Please help.
Is algebra.

Please help Is algebra class=

Respuesta :

xiligxn
xiligxn xiligxn
  • 04-04-2021

Answer:

1. 6a^3

2. -6n^4

3. -7a

Step-by-step explanation:

Hope this helps

Answer Link

Otras preguntas

The number of degrees of freedom for a test cross of an ss/rr individual would be
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
An important change in the american family in the nineteenth century was
Embryological evidence suggests that the echinoderms are closely related to the ______________. arachnids annelids arthropods chordates
An increase in immigrants to Texas led to _________ education. A. extracurricular B. higher C. mandatory D. bilingual
Please help me out with this
how many moles of NaCl are equivalent to 15.6g NaCl
Please help me with this one too !!!
Less developed countries (LDCs) have a/an____ population growth. A.average B. negative C. positive D. unchanged
Which event in the typical life cycle of sexually reproducing fungi involves transition from a haploid to a diploid stage?