margon66544
margon66544 margon66544
  • 02-03-2021
  • Mathematics
contestada

Help me please help please

Help me please help please class=

Respuesta :

alatiatjoman
alatiatjoman alatiatjoman
  • 02-03-2021

Answer:

5

Step-by-step explanation:

50  by divded 5 is 10 90 divided by 5 is 18 and 110 divded  by 5 is 22 hope this helps!

Answer Link

Otras preguntas

Consider the function. What is the y-intercept of f–1(x)? –16 –12
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Wilson Center is a private not-for-profit voluntary health and welfare entity. During 2017, it received unrestricted pledges of $600,000, 60 percent of which we
Please help me out with this! Very much appreciated!!
baptiste walked 420 m in 17.5 min. what is his average speed in m/min? what is his average speed in m/s?
Passive and active I want understand
Debbie works as a floor representative at a cellular phone company. Her job is to receive information from potential customers about their needs and interests a
PLEASE HELP ASAP!!! When would you use a line graph? A. if the data is given as data pairs B. if the data is numerical C. to compare categories D. to com
According to the video, what are some qualities needed by Registered Nurses? Check all that apply compassion knowledge of laboratory techniques leadership skill
Which part of the excerpt contains a paradox?