snehaojh54321 snehaojh54321
  • 04-01-2021
  • Social Studies
contestada

What are the 4 efforts that are required to strengthen federalism in nepal?

Respuesta :

GayPride01
GayPride01 GayPride01
  • 04-01-2021

Answer:

Federalism in Nepal: Issues and Challenges ... concentration of power and opposed to every effort of the devolution of power. ... A country may have federal ... autonomous regions and districts elected by the people in order to strengthen.

Explanation:

Answer Link

Otras preguntas

epistrophe literary definition
Explain how an enlargement or a reduction in the dimensions of a building would cause a change in the scale factor.
what is 3(2x-4)=5x+2
Don’t know how to this, solve for x
Which type of bone has the least amount of spongy bone relative to its total volume?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Pete slid a domino off a bridge and it took 2.3 seconds to hit the Gully below how many feet did the domino fall
According to engels, what purpose did government serve? a. to organize production c. to create new jobs b. to revolt against workers d. to pass laws ending oppr
Katy invests a total of $26,500 in two accounts paying 4% and 9% annual interest, respectively. How much was invested in each account if, after one year, the to
The learning curve describes the ________ relationship between ________ and ________