reaperofsoulz14 reaperofsoulz14

03-09-2020
Physics

contestada

If the Speed limit is 60 mph, if I drive at a speed of 130 km/hr would I maybe get a ticket? (0.621 mi = 1km)

Respuesta :

ChoiSungHyun ChoiSungHyun

03-09-2020

Explanation:

130km = (0.621 * 130) mi = 80.73 mi

So if you drive at 80.73 mph you will get a ticket for speeding over the limit.

Answer Link

Otras preguntas

why did the church oppose the heliocentric theory

During the germinal period of prenatal development, some cells become part of the brain, some become part of the leg, and some become part of the stomach, etc.

A student is conducting an experiment to determine how far a ball will roll down a ramp based on the angle of incline. What are the independent and dependent

What advice would you give someone whose life dream is to become a judge?

The actions of the pueblo indians at santa fe in 1680 can best be described as:

Which style of art is distinguished by texture oli paint ,solid forms suggested by shape imprecise lines ,and intermingled colors

The degree measure of angle a is 135°. which expression below is equivalent to the radian measure of angle a?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

(-5x^2)^3 plzzzz help

Researchers are exploring whether treatment with ________ might improve social behavior in those with asd.