leaahht leaahht
  • 01-09-2020
  • Mathematics
contestada

6y-10y-11=8y-2y+29 step by step?

Respuesta :

xiwengoh
xiwengoh xiwengoh
  • 01-09-2020

Step-by-step explanation:

6y - 10y - 11 = 8y - 2y + 29

6y - 10y +16y - 11 = 8y - 2y + 29 + 16y

-11 = 22y + 29

11 = 22y + 40

-29 = 22y

Not sure yet I think I made a mistake hold up

Answer Link

Otras preguntas

Find f(x) if it is known that f(x−2)=2x−4.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A sharp type of pain from the abdomen that travels along neural routes
who invented the glass harmonica
If 100 kg of cucumbers are 99% water, how much do they weigh if they are 97% water?
what is the value of the expression i × i²× i³× i⁴
this is a class called foundation seminar music and math
6. Which of the following is a consequence of chronic alcohol use? A. gastritis B. stomach ulcers C. heartburn D. All of the above
Can someone please help me with numbers 1, a, b, c, 2, a, b, c
The bretton woods system ended in select one: a. 1945. b. 1973. c. 1981. d. 2001.