Soccergirl9463 Soccergirl9463
  • 01-04-2020
  • Social Studies
contestada

How did scientist know prehistoric Indians existed if they didn't have a way to write things

Respuesta :

octaviablake2004 octaviablake2004
  • 01-04-2020

Answer:

fossilised skeletons

Explanation:

Answer Link

Otras preguntas

Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
what rule does static electricity follow
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how can you write 0.45 as fraction and a percentage ,please show work
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
Tu as quels cours le jeudi matin?