spencebrod1 spencebrod1
  • 05-04-2019
  • Mathematics
contestada

If 12 pens cost 3.48 how much do 20 cost

Respuesta :

kosala1478
kosala1478 kosala1478
  • 25-07-2019

Step-by-step explanation:

12/3.48= cost of 1 book

cost of 20 books = 12/3.48×20 =68.95

Answer Link

Otras preguntas

A 5-card hand is dealt from a deck of 52 cards. what is the probability that 4 are hearts
Studies of populations that reveal correlations between dietary habits and disease incidence are
Which graph is a translation of f(x)=x^2, according to the rule: y=(x-2)^2
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Find the missing length indicated
Bartók's Concerto for Orchestra is written for A. full orchestra and singer. B. string quartet and orchestra. C. full orchestra. D. full orchestra
Use the excerpt to answer the question. We hold these truths to be self-evident: that all men and women are created equal; that they are endowed by their Creato
If a family has three children, what is the probability that the family has at least one girl?
Which correctly describes the reaction between potassium and excess water?
If o- can give to every other blood type, why cant it recieve other blood types