myldredsolo myldredsolo

01-03-2019
Mathematics

contestada

A right triangle has one 64degree angle and one 90 degree angle

Respuesta :

emma82310 emma82310

01-03-2019

Answer:

I dont know what your asking, for the other angle? Ig so. Answer: THE OTHER ANGLE IS 26. :)

Step-by-step explanation:

64 + 90 = 154.

All triangles add up to 180 degrees.

180-154 = 26.

Answer Link

Otras preguntas

There is no universally agreed-upon definition of cultural competence.

Part 1: find the slope of the line that passes through the points (2, 1) and (2, 0). part 2: in two or more complete sentences, explain why it is not possible t

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Can you give me a short summary (a sentence or two) on Shakespeare’s Macbeth. And what it is.

-6.8 + (-12) + (-72.3).

How many natural numbers less than 300 are either multiples of 2 or multiples of 3?

What law required Northerners to assist in the return of runaway slaves

What is the main reason night driving is more difficult than daytime driving?

which combination of quarks produces a neutral baryon

Find the area bounded by the curves x = y2 - 4y and x = 2y - y2. Your work must include an integral in one variable.