s27111855 s27111855

04-04-2016
Computers and Technology

contestada

All the processing-of work-done on a computer is performed by the what?

Respuesta :

Аноним Аноним

04-04-2016

it's computed by the processor

Answer Link

Otras preguntas

Please help! I will give brainly! Which of the four inventions was the most important to the world? Include an explanation in your response.

What are the protein molecules that make possible chemical reactions in living things.

please help with all! thank you!!

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

a warrant, which specifies the location that can be searched and exactly what can be legally seized, must be issued by a

Brian was thinking of a number. Brian subtracts 7.1 from the number and gets an answer of 8.8. Form an equation with x from the information.

I (1. not like/ watch) _______________________ football.

S O L V E (litteraly please im not failing again)

.......... is the multiple identify the integers 0 1 2 -1

Solve the following system of equations.