Bigdon89
Bigdon89
02-10-2018
English
contestada
how is tone related to a point of vew in a story
Respuesta :
artisan2005
artisan2005
02-10-2018
the tone can show how the person in point of veiw feels about the topic, and also how they felt about it, too!
Answer Link
VER TODAS LAS RESPUESTAS ( 42+ )
Otras preguntas
OMS Manufacturing expects to produce and sell 12000 units of Big, its only product, for $20 each. Direct material cost is $3 per unit, direct labor cost is $10
A boy pedals his bicycle with a net horizontal force of 235 N. If the total mass of the boy and the bike is 40 kg, how much are they accelerating
The short-run tradeoff between inflation and unemployment implies that, in the short run, a. a decrease in the growth rate of the quantity of money will be acco
A car travels for 18 minutes at an average of 72km/h. How far will the car travel in 18 minutes?
How to draw something
Which sequence isn’t a geometric progression? A. 2, 6, 18, 54 B. 1, 5, 25, 125 C. 3, 6, 9, 12 D. 4, 8, 16, 32?
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
the absolute tempertaure of a gas is increased four times while maintaining a constant volume . what happens to the pressure of the gas
Kerry bought a conical tent to put on the back porch. The tent instructions reveal the height at the tallest point to be4.5 feet and the space inside to be 10.5
A solution was prepared by dissolving 125.0 g of KCl in 275 g of water. Calculate the mole fraction of KCl. (The formula weight of KCl is 74.6 g/mol. The formul
